©Christine L. Case Skyline College To CPS index
Build A Molecular Clock: The Origin of HIV
Background Viruses in the family Retroviridae contain single-stranded RNA and the enzyme reverse transcriptase. Five serogroups of the genus Lentivirus are recognized, based on their hosts: primates, sheep and goats, horses, cats, and cattles. SIV and HIV are primate-associated lentiviruses; and HIV-1 is the type species of the genus. The primate lentivurses are distinguished by their use of CD4 as a receptor. The oldest known HIV-1 was isolated from 1959 plasma sample from a adult male from Kinshasa, Republic of Congo.
Viral species are defined by their nucleic acids and their ecological niches. The ecological niche of a virus is its host cell and most viruses are host-cell specific. HIV-1 and HIV-2 infect humans: SIVagm infects the African Green Monkey (Chlorocebus spp.) and SIVcpz infects chimpanzees (Pan troglodytes). However, nucleic acids accumulate mutations over time and a mutated virus, capable of growing in a new host, may be able to cross this "species barrier" if given the opportunity.
Cladograms are maps that show evolutionary relationships among organisms. You have probably seen cladograms showing the relationships between different organisms. Sometimes these cladograms are referred to as "The Tree of Life."
Each branch point on the cladogram is defined by a feature shared by all species on that branch. Historically, cladograms for vertebrates were made using fossil evidence. Now, molecular evidence from rRNA sequences are being used to confirm assumptions based on fossils. Viruses and most unicellular organisms do not leave fossils; therefore, molecular sequences are used to show evolutionary relationships in these organisms. Ribosomal RNA is used is determine relationships between cellular organisms. Amino acid sequences are being used to uncover the origin and relationships of viruses because viruses do not have ribosomes. Click here to see the steps to make a cladogram for a virus.
The Problem Build a cladogram to show the relatedness between the three strains of HIV-1 and two strains of SIV shown below. A portion of the pol gene for reverse transcriptase (a DNA polymerase) for five lentiviruses is given. The antisense strand of DNA is provided.
Data You do not need to print this page. You can Edit/copy the sample DNA and Edit/paste into a word processing program to have a working copy of your DNA sample.
>Sample 1: African Green Monkey (SIVagm) 5' ttttcgctatgggtgctggagatagtgtctatagcgggcaatatcggcgacaaaaagacaggtttatttaacgaaggaatgg >Sample 2: Human (HIVbru) 5' ttatcggcatggttaaaggaataaagagtgctaagtttagaagcaatcttaggtttgaaaaaattagataacgatgcccc >Sample 3: Human (HIVsc) 5' ttttcgctatggaacctgggatctttagtttgaaatgggagagcccattccgcctggaaaaaattagataaggtaaggccgc >Sample 4: Human (HIVcdc) 5' tttccgtcatggaacctggaatagttgctcaaaagtgggagcaaccgcttaggtttgaaaaaattagataagggcgg >Sample 5: Chimpanzee (SIVcpz) 5' ttatcggcatggttaaaggaataaagagtgctaagtttagaagcaatcttaggtttgaaaaaattagataacgatgcccc
>Sample 1: African Green Monkey (SIVagm) 5' ttttcgctatgggtgctggagatagtgtctatagcgggcaatatcggcgacaaaaagacaggtttatttaacgaaggaatgg
>Sample 2: Human (HIVbru) 5' ttatcggcatggttaaaggaataaagagtgctaagtttagaagcaatcttaggtttgaaaaaattagataacgatgcccc
>Sample 3: Human (HIVsc) 5' ttttcgctatggaacctgggatctttagtttgaaatgggagagcccattccgcctggaaaaaattagataaggtaaggccgc
>Sample 4: Human (HIVcdc) 5' tttccgtcatggaacctggaatagttgctcaaaagtgggagcaaccgcttaggtttgaaaaaattagataagggcgg
>Sample 5: Chimpanzee (SIVcpz) 5' ttatcggcatggttaaaggaataaagagtgctaagtttagaagcaatcttaggtttgaaaaaattagataacgatgcccc
Use the Genetic Code in your textbook or click here for the code and amino acid abbreviations
Questions
Back to top